Initial Publication Date: June 23, 2009
DOI | Cite this

Supplies and Equipment Needed for "Human SNP Determination" Lab Activity


Return to Main Lab Page

For the first lab session, "DNA Isolation and PCR"

For students in each lab section (20-24 students) to share:

  • 1 thermal cycler for doing PCR
  • 1 waterbath set to 56 degrees C
  • 2 microfuges which will run at 8000 rpm (1 microfuge would be okay)
  • adaptors for spinning PCR tubes in the microfuge (or use 0.6 ml tubes with lids removed placed inside 1.6 ml tubes with lids removed)
  • 1 box of gloves in each size (S, M, L)
  • 4 vortexers
  • 4 boxes each of stuffed/aerosol pipette tips, for P20 or P10 micropipettes and for P200 micropipettes (these will get used only for the final steps when students set up their PCR reactions)
  • 1 DNeasy Blood and Tissue Kit per 50 DNA isolations (from QIAGEN, catalog number 69504)
  • 1 extra bottle of Buffer AL for DNA extraction per 200 DNA isolations (from QIAGEN, catalog number [link https://www.qiagen.com/us/products/catalog/lab-essentials-and-accessories/buffer-al/
    '19075']
  • 1 box of PuReTaq Ready-To-Go PCR Beads per 96 PCR reactions (order enough to have students run a known sample of DNA if you'd like) (from GE Healthcare
  • tube labels (page 1 (Microsoft Word 75kB Apr24 07), page 2 (Microsoft Word 84kB Apr24 07) with PCR machine designations
  • 1 clean, used 96-well plate to store PCR tubes in after they are taken out of the thermal cycler

Per lab group (2-3 students):

  • 2-3 sterile cheek swabs (Whatman OmniSwabs, available from VWR, catalog number 12000-611) (1 swab per student)
  • 1 microfuge tube floater capable of holding 2-3 tubes (1 tube per student)
  • 1 P1000 micropipette
  • 1 P200 micropipette
  • 1 P20 (or P10 if available) micropipette
  • 1 box sterile yellow pipette tips
  • 1 box sterile blue pipette tips
  • 1 box lab tissues (like Kimwipes)
  • 1 jar sterile 1.5 ml or 1.6 ml microfuge tubes (each student in the group needs a minimum of 2 microfuge tubes for the DNA isolation)
  • 1 microfuge tube rack
  • 2-3 test tubes (we use used 15 ml conical plastic tubes, but you could substitute whatever you have that is approximately the right size--their cheek swabs just need a place to dry upright for 15 minutes)
  • 1 rack to hold 15 ml conical plastic tubes (or other test tube as described above)
  • 1 rack for PCR tubes
  • 1 ice bucket

Aliquots for each group of 3 students:

  • 1.5 ml sterile PBS
  • 1.5 ml 200 proof ethanol
  • 1.5 ml Buffer AL (from QIAGEN kit above, plus extra needed (we use more than the kit calls for, in order to submerge the cheek swabs)
  • 1.6 ml Buffer AW1 (from QIAGEN kit above)
  • 1.6 ml Buffer AW2 (from QIAGEN kit above)
  • 700 microliters Buffer AE (from QIAGEN kit above)
  • 85 microliters primer stock (see notes below)

Other aliquots:

  • 1 tube Proteinase K per 50 PCR reactions (from QIAGEN kit above; we have the TA or lab instructor pipette this for the students as they need it, since the volume used is small)
  • Heterozygote DNA: We identified a heterozygote for this SNP in our department and perform a DNA isolation prior to the lab sections. Then during each lab, we ask the TA's to set up four PCR reactions using this heterozygote DNA. The second week of labs, each lab group then digests a sample of this and runs a lane on their gel with the cut known heterozygote DNA as a control and additional marker lane for comparison. For the purpose of aliquotting, we provide each TA with enough heterozygote DNA to run a PCR reaction for each pair of lab groups (in our course, each lab section has 8 lab groups, so the TA runs 4 PCR reactions). Each PCR reaction requires 1 microliter of DNA.

Ordering and preparing primers:

We order the following two primers for this lab (from Operon Biotechnologies):

  • FORWARD: 5' AAGGGCGTGTAGCACAGCATAAAG 3'
  • REVERSE: 5' ACCAGGAAGGGACTGGAAGAGATT 3'

We then dilute each of these to 5 micromolar stocks. For the lab, we mix the primers together with sterile water so that each primer has a concentration of 0.2083 micromolar. This means that the primers will be at a final concentration of 0.2 micromolar when we mix it with the DNA in the PCR tube.

For the second lab session, "Restriction Enzyme Digest and Gel Electrophoresis"

For students in each lab section (20-24 students) to share:

  • 1 waterbath set to 37 degrees C
  • 2 microfuges just to spin fluid to the bottom of the tube (1 microfuge, or low-speed table-top models, would be okay)
  • 1 box of gloves in each size (S, M, L)
  • 1 large carboy of TBE for making and running gels
  • 2 balances capable of weighing 0.8 g of agarose (1 balance would be okay)
  • 2 spatulas or other implements to scoop and weigh agarose
  • weigh boats for agarose (1 per lab group, or have students re-use)
  • access to a microwave to melt agarose
  • agarose near the balances; need a minimum of 0.8 g per gel
  • GelStar DNA stain, available from Lonza, catalog number 50535; enough for each lab group to use 4 microliters
  • 1 UV transilluminator and camera for observing and photographing gels

Per lab group (2-3 students):

  • 1 potholder or equivalent for handling hot flasks of agarose
  • 1 microfuge tube floater capable of holding 4 tubes (1 tube per student plus 1 tube for heterozygote DNA)
  • 1 50 ml or 100 ml graduated cylinder for measuring TBE used in making agarose
  • 1 250 ml flask for making up 40 ml of agarose
  • 1 agarose gel casting tray
  • 1 gel comb with eight teeth to make an eight-well gel
  • 1 gel rig
  • 1 power supply for the gel rig
  • 1 P20 (or P10 if available) micropipette
  • 1 box sterile yellow pipette tips
  • 1 square plastic sandwich box for transporting gel
  • 1 box lab tissues (like Kimwipes)
  • 1 jar sterile 1.5 ml or 1.6 ml microfuge tubes (each student in the group needs 2 microfuge tubes for their samples, plus 1 tube for the heterozygote DNA)
  • 1 microfuge tube rack
  • 1 rack for PCR tubes
  • 1 ice bucket

Aliquots for each group of 3 students:

  • 8 microliters of 100 bp DNA marker (available at NEB, catalog number N3231), which has been diluted with water from 0.5 mg/ml to 0.0625 mg/ml (an 8x dilution)
  • 4 microliters of Hpa II (available at NEB, catalog number R0171); we usually put enough for the whole lab section in a tube (40 microliters for 8 groups of three) and ask the TAs to dispense it
  • 8 microliters of NEBuffer 1, which comes with the Hpa II enzyme
  • 1 tube containing loading dye, at least 16 microliters; for this gel we use 50% glycerol and 0.4% xylene cyanol in water; bromophenol blue (which we otherwise use at 0.4% along with xylene cyanol in our loading dye) can get in the way of viewing the smaller DNA bands in which we're interested.

Return to Main Lab Page